Supp Material.doc - Genes & Development

1MB Size 3 Downloads 10 Views

5'- CCA TCA CCA TCT TCC AGG AGC GA-3' ... The recombinant plasmid coding for the MS2 hybrid RNA and the selection markers ADE2 and URA3 was ...
SuppLEMENTAL INFORMATION

Translational regulation of Glutathione peroxidase 4 Expression through Guanine-rich sequence binding factor 1 is essential for embryonic brain development.

Christoph Ufer1,2), Chi Chiu Wang3,4), Michael Fähling5), Heike Schiebel1), Bernd J. Thiele5), E. Ellen Billett2), Hartmut Kuhn1) and Astrid Borchert1)

1)Institute of Biochemistry, University Medicine Berlin - Charité, Monbijoustr. 2, D-10117 Berlin, F.R. Germany, 2)School of Science and Technology, Nottingham Trent University, Clifton Lane, Nottingham, NG11 8NS, United Kingdom, 3)Li Ka Shing Institute of Health Sciences and 4)Department of Obstetrics and Gynaecology, The Chinese University of Hong Kong, Shatin, Hong Kong, 5)Institute of Physiology, University Medicine Berlin - Charité, Tucholskystr. 2, D-10117 Berlin, F.R. Germany

1. Methodological details 1.1. PCR primers The sequence of the oligonucleoitides used for qRT-PCR (different purposes) are given below (Table S1).

|Gene product|Direct|Sequence | | |ion | | |GPx4 5’UTR probe used for the yeast three hybrid screen | |m-GPx4 |Forwar|5’- CAG GGG CCT CGC GTC TTA GCG-3’ | | |d | | | |Revers|5’- CAT CTC GGC GGC CGG AGC CA-3’ | | |e | | |GPx4 5’UTR probe used for the RNA mobility shift assay | |m-GPx4 |Forwar|5’- TAA TAC GAC TCA CTA TAG GGT ACT CAG GGG | | |d |CCT CGC GTC TTA GCG-3’ | | |Revers|5’- GGG GGC TAG CTC TCG GCG GCC GGA GCC AGC | | |e |G-3’ | |Grsf1 coding sequence for mammallian expression | |Grsf1 |Forwar|5’- GAA TTC GCC ATG GCC GGG ACG CGC TGG GTG | | |d |CTA G-3’ | | |Revers|5’- AAG CTT ATT TTC CTT TAG GAC ATG AAT TTA | | |e |GGA-3’ | |Quantitative RT-PCR | |Grsf1 |Forwar|5’- GAA TCC AAA ACT ACC TAC CTG GAA G-3’ | | |d | | | |Revers|5’- CAG CTG TAA GGA AGT CCT CTC AG-3’ | | |e | | |m-GPx4 |Forwar|5’- GAG ATG AGC TGG GGC CGT CTG A-3’ | | |d | | | |Revers|5’- ACG CAG CCG TTC TTA TCA ATG AGA A-3’ | | |e | | |GAPDH |Forwar|5’- CCA TCA CCA TCT TCC AGG AGC GA-3’ | | |d | | | |Revers|5’- GGA TGA CCT TGC CCA CAG CCT TG-3’ | | |e | | |m-GPx4 |Forwar|5’- CGT CCA TTG GTC GGC TGC GTG | |(RNA-IP) |d | | | |Revers|5’- TCC TGG CTC CTG CCT CCC AAA C | | |e | | |Grsf1 coding sequence for prokaryotic expression | |Grsf1 |Forwar|5’- GGA TCC GGG ACG CGC TGG GTG CTA G-3’ | | |d | | | |Revers|5’- CCC CGC GGC CGC TTA TTT TCC TTT AGG ACA | | |e |TGA ATT TAG G-3’ | |K6-Grsf1 |Forwar|5’- CCC CGG ATC CAT TGG GCA CGG GAA CAA GGG | | |d |AC-3’ | | |Revers|5’- CCC CGC GGC CGC TTA TTT TCC TTT AGG ACA | | |e |TGA ATT TAG G-3’ | |In situ hybridization probes | |Krox20 |Forwar|5’- TCA TAG GAA TGA GAC CTG GGT CCA T-3’ | | |d | | | |Revers|5’- AGA TGG CAT GAT CAA CAT TGA CAT GA-3’ | | |e | | |Gbx2 |Forwar|5’- TCG GGG CTG TCC GAG GGC AAG-3’ | | |d | | | |Revers|5’- GCT GCT GGT GTT GAC TTC GAA TAG-3’ | | |e | | |Grsf1 |Forwar|5’- GAA TCC AAA ACT ACC TAC CTG GAA G-3’ | | |d | | | |Revers|5’- CTT CTC CCT CTA TAG TCC ATC ACA A-3’ | | |e | | |m-GPx4 |Forwar|5’- AAGGCTTCGGCCTCGCGCGTCCATTGGT-3’ | |(anti-sense)|d | | | |Revers|5’- | | |e |TAATACGACTCACTATAGGGCACAGCAGTGCTGGCTTAAGTAAG-3| | | |’ | |m-GPx4 |Forwar|5’- TAATACGACTCACTATAGGGCGGCCTCGCGCGTCCATTGGT | |(sense) |d | | | |Revers|5’-AAGCTTCACAGCAGTGCTGGCTTAAGTAAG | | |e | |



1.2. Yeast three-hybrid system The yeast three-hybrid system is a screening method for detection of RNA binding proteins. We used this method to screen a murine testis expression library for proteins capable of binding to the 5’-UTR of the m- GPx4 mRNA. For this purpose we amplified the 5’-UTR by PCR using the primer combination indicated in Table S1 (supplemental data). PCR resulted in a 146 bp product representing the 5’-UTR. This fragment was cloned into the vector pIIIA/MS2-1 using the SmaI restriction site. The recombinant plasmid coding for the MS2 hybrid RNA and the selection markers ADE2 and URA3 was introduced into the yeast strain YBZ-1. The yeast strain YBZ-1 bears the reporter genes HIS3 and LacZ in its genome and is auxotroph for histidine, leucine, uracil and adenine. The initial transformation was followed by large-scale transformation (200 µg plasmid DNA) of the cells with a commercial mouse testis cDNA library (Clontech, Palo Alto, USA) that encodes for testicular proteins fused to an N-terminal GAL4 transcriptional activation domain and the selection marker LEU2. Double transformants were grown in a medium (deficient in essential amino acids Leu and His) selecting for activation of the reporter gene HIS3 and the presence of the of the library plasmid pACT2 as well as containing 2,5 mM 3-aminotriazol (3- AT) to suppress background growth. 3-AT is a competitive inhibitor of the HIS3 gene product. Initial selection was not for the maintenance of the RNA plasmid. Clones with RNA-independent reporter gene activation will grow independent of the plasmid pIIIA/MS2-1 and eventually lose it. Since this plasmid confers ADE2 prototrophy, RNA-independent clones that lost the plasmid will start de novo synthesis of adenine once the adenine in the medium becomes low. This leads to accumulation of a red purine metabolite due to the lack of the ADE2 gene product and thus renders yeast colonies pink. From 107 transformants about 1300 white clones (His+ and Leu+ prototrophes) were selected for further analysis. First, activation of the second reporter gene ß-galactosidase was assayed by direct measurement of enzyme activity using 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal). About 95% of the initial clones also activated the second reporter gene. To see whether the reporter gene activation is dependent on the hybrid RNA these yeast clones were subjected to two rounds of URA3 counter selection. Clones were cured of the pIIIA/MS2-1 plasmid in the presence of Uracil and 0.1% 5-fluoroorotic acid (5-FOA) and activity of the reporter gene ß-galactosidase was assayed for. The URA3 gene product converts 5-FOA to toxic 5-fluorouracil. Thus only clones lacking the plasmid pIIIA/MS2-1 will grow in the presence of 5-FOA. Only 2% of these clones were truly RNA- dependent. Into the remaining clones control plasmids (pIIIA/MS2-1 lacking the m-GPx4-5’UTR or expressing the GPx4-5’UTR in the reverse-complementary orientation) were introduced for determining sequence specificity by using mating assay. For this purpose the control plasmids were introduced into the yeast strain R40-coat (MAT(). These clones were mated to the YBZ-1 (MATa) clones resulting from the previous URA3 counter selection being devoid of the plasmid pIIIA/MS2-1. Diploid cells were selected on selection medium (-Leu, -His, -Ura) for the presence of both plasmids (pACT2 and pIIIA/MS2-1) and activation of the reporter gene HIS3 and activity of ß- galactosidase was tested. Eventually, specificity of reporter gene activation was confirmed by co-transformation experiments and selection on selection medium (-Leu, -His, -Ura) in the presence of 80 µg/ml 5-bromo-4- chloro-3-indolyl-beta-D-galactopyranoside by colony growth and color.

1.3. 5’-UTR-driven reporter gene assays To explore the impact of Grsf1 on translation of the m-GPx4 mRNA, UTR- dependent reporter gene assays were carried out. For this purpose a modified pGL3-promoter vector (Promega, Mannheim, Germany) was used. The vector specific 5’-UTR of luciferase mRNA was replaced by the GPx-4 5’-UTR using HindIII (5’-end) and NcoI (3’-end) restriction sites. For the deletion experiments the AGGGGA motif was removed by PCR. For Grsf1 expression in mammalian cells the coding region of Grsf1 was cloned into pcDNA3.1(-) (Invitrogen, Karlsruhe, Germany) using primers as specified in table 1 (supplemental data) containing restriction sites for EcoRI and HindIII respectively. The structures of all modified vectors were confirmed by DNA sequencing. Mouse embryonic fibroblast (mEF ras/TAg) cells (Ryan et al. 2000) were maintained in Dulbecco’s modified Eagle’s medium (high glucose; PAA Laboratories GmbH) supplemented with 10% heat-inactivated fetal calf serum, 50 U/ml penicillin, 50 µg/ml streptomycin, 15 mM Hepes and 2 mmol/l glutamine at 37°C, 5 % CO2 in 96-well plates (µClear Platte 96K, Greiner BIO-ONE GmbH). Before use cells were maintained in a medium containing 0.4% fetal calf serum for at least 24 h. Cells were co- transfected with the modified Firefly-luciferase pGL3-promoter vector (Promega, Mannheim, Germany) and the Renilla-luciferase phRL-TK vector (transfection control) using the MagnetofectionTM PolyMag transfection system (OZ Biosciences, Marseille, France) according to the manufacture’s instruction. Following transfection (20 min on a magnetic plate) the transfection medium was replaced with fresh medium containing 10% heat- inactivated fetal calf serum. Co-transfection with an expression vector encoding the Grsf1 trans-factor was used in a ratio 1:2.5 (Firefly- luciferase vector : Grsf1-expression vector). In order to avoid differences in the amount or ratio of the constitutive CMV-promoter in the kinetic study we successively replaced the empty expression vector (backbone vector) with the expression vector encoding the Grsf1 protein. Luciferase activity was detected after 6 h using the Dual-GloTMLuciferase Assay System (Promega, Mannheim, Germany) and a luminometer (Labsystems Luminoscan RS) programmed with individual software (Luminoscan RII, Ralf Mrowka). Results are given as means ± SD. Data were analyzed using the Student’s t-test, and null hypothesis was rejected at the 0.05 level.

1.4. Quantitative RT-PCR (qRT-PCR) qRT-PCR was carried out with a Rotor Gene 3000 system (Corbett Research, Mortlake, Australia) using the QuantiTect SYBR Green PCR Kit from Qiagen (Hilden, Germany). The following PCR protocol was applied (Borchert et al. 2006): 15 min hot start at 95 °C, followed by 40 cycles of denaturation (30 sec at 94°C), annealing (30 sec at 65°C) and synthesis (30 sec 72°C) in a total volume of 10 µl. Homogeneity of the amplified PCR products was tested recording the melting curves. For this purpose the temperature was elevated slowly from 60°C to 99°C. Amplification kinetics were recorded in the real-time mode as sigmoid process curves, for which the fluorescence was plotted against the number of amplification cycles. To generate standard curves for exact quantification of the expression levels, specific amplicons were used as external standards for each target gene. The initial amplicon concentrations varied between 5 x 103 and 3 x 106 copy numbers. GAPDH mRNA was used as internal standard to normalize expression of the target transcripts (Grsf1 and m-GPx4). Absolute ratios of the target mRNA species and the GAPDH mRNA were calculated using these standard curves. All RNA preparations were analyzed at least in triplicates and means ± SD are given. The experimental raw data obtained during amplification were evaluated with the Rotor-Gene Monitor software (version 4.6).

1.5. Recombinant expression of Grsf1 Grsf1 was expressed in E. coli as a glutathione transferase (GST) fusion protein. It was purified from the bacterial lysate supernatant by affinity chromatography on a glutathione agarose column. For this purpose the coding regions of murine Grsf1 (Nm_178700) and K6-Grsf1 (splicing variant) were amplified using the primers specified in table 1 (supplemental data) containing the recognition sequences for BamHI (5’- primer) and NotI (3’-primer). The PCR products were cloned into the plasmid pGEX-4T-3 (Amersham, Freiburg, Germany) using the Bam HI and Not I restriction sites present in the vector. The resulting plasmids pGEX-4T- 3/Grsf1 and pGEX-4T-3/K6-Grsf1 were then transformed into E. coli (strain BL21, Amersham, Freiburg, Germany). Expression was induced with 0.5 mM isopropyl α-D-thiogalactoside and bacteria were incubated at 30° C for 1 h. Cells were lysed by sonication and the 10,000 g lysis supernatant was used as starting material for affinity chromatography on a glutathione-agarose column (Sigma, Deisenhofen, Germany). GST-tagged recombinant proteins were eluted from the column using a step gradient of reduced glutathione reaching a final concentration of 10 mM in 50 mM Tris-HCl, pH 9,5.

1.6. RNA immunoprecipitation In order to detect in vivo RNA/protein interactions RNA immunoprecipitation was performed. In brief, 2x106 murine neuroblastoma N2a cells (maintained in 90% DMEM, 10% FBS, 2 mM L-glutamine, 100 units/ml penicillin, 10 µg/ml streptomycin (Sigma, UK) at 37°C in a humidified atmosphere of 95% air/5% CO2) were washed twice with phosphate buffered saline (PBS) and fixed in 1% formaldehyde for 20 min at room temperature. The reaction was stopped with 150 mM glycine, cells were washed twice with PBS, resuspended in RIPA buffer (50 mM Tris-HCl, pH 7.5, 1% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA, 140 mM NaCl, 1.5 mM MgCl2, 1 mM DTT, 80 u/ml RNasin (Promega, Southampton, UK) and EDTA-free proteinase inhibitor mini cocktail (Roche Diagnostics Ltd., UK) was added. After sonication lysates were cleared by centrifugation at 16,000g for 15 min at 4º C followed by the addition of 60 (l protein A or G agarose (Upstate, CA, USA) to the supernatant and subsequent agitation at 4oC for 3 hours. Agarose beads were then pelleted by low speed centrifugation and the pre-cleared supernatants were incubated over night at 4oC with 10 (g of a polyclonal anti-Grsf1 antibody (Abcam, Cambridge, UK), monoclonal anti-FLAG M2 antibody (Sigma, UK), polyclonal anti-mouse immunoglobuline (Dako, Denmark) or without antibody in the presence of 50 u/ml SuperRNAseIN (Ambion, Huntingdon, UK). Immune complexes were precipitated by addition of 60 (l protein A or G agarose and low speed centrifugation. Precipitates were washed once with 1 ml of each of the following buffers in the presence of 50 u/ml SuperRNAsIN (Ambion, Huntingdon, UK): RIPA buffer; low salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl [pH8.0]); high salt buffer (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl [pH8.0]); LiCl buffer (0.25 M LiCl, 1% NP-40, 1% Na-deoxycholate, 1 mM EDTA, 10 mM Tris [pH8.0]) and twice with TE buffer (10 mM Tris-HCl [pH8.0], 1 mM EDTA). Finally protein/RNA complexes were eluted with 250 (l elution buffer (100 mM Tris-HCl [pH 7.8], 10 mM EDTA, 1% SDS). Eluates and an aliquot of cleared lysate (“Input”) were adjusted to 100 mM NaCl and incubated with 20 (g proteinase K (Ambion, Huntingdon, UK) at 42º C for 1 hour and at 65ºC for 1 hour followed by RNA extraction using TRI Reagent (Ambion, Huntingdon, UK) according to the vendor’s instructions. After DNA digestion (TURBO DNA-free kit from Ambion) RNA was reversely transcribed with SuperScript II (Invitrogen) following standard protocols. The resulting cDNAs were amplified and quantified using a quantitative PCR approach as described above. The primer sequences are given in the Supplemental Information, Table S1.

2. Supplemental experimental data

2.1. Co-transformation experiments confirm specific binding of Grsf1 to the m-GPx4 5’UTR in yeast High binding specificity as revealed by the yeast three hybrid screen was confirmed by co-transformation experiments (Fig. S1 A, B), which indicated that activation of the lacZ reporter gene (blue staining) was only observed when all hybrids were correctly expressed. [pic] Figure S1. Screening of a murine testis expression library with the yeast three-hybrid system indicates Grsf1 as m-GPx4 mRNA binding protein. Panel A: Different RNA baits were constructed to confirm binding specificity. The original bait (pIIIA/MS2-1 GPx4-5’UTR) contains the m-GPx4 5’-UTR in sense orientation, whereas a reverse-complementary orientation was chosen for the control bait. The second control bait does not contain any GPx4 sequences. Transcription initiation sites are indicated by a (Nam et al. 1997) and b (Knopp et al. 1999). Panel B: Plasmids encoding the activation domain (AD) of the K6-Grsf1 fusion protein (pACT2 Grsf1) were co- transfected into yeast cells (strain YBZ-1) together with plasmids containing the different RNA baits. The cells were plated onto selective media (lacking adenine, uracil and leucine) that contained 80 (g/ml 5-bromo- 4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal). Reporter gene activation of the LacZ gene is indicated by blue color (positive clones), which indicates X-gal metabolism (activation of the reporter gene LacZ). If LacZ is not activated colonies retain their normal white color. No significant cell growth was seen when only one plasmid was transfected. Pink colonies result when purine metabolites accumulate and this is due to the absence of the pIIIA/MS2 vector (lack of ADE2-encoded enzyme).

2.2. Thrombin cleavage of the recombinant K6-Grsf1-GST fusion protein does not alter the RNA binding properties For routine electrophoretic mobility shift assays we usually used the recombinant K6-Grsf1/GST fusion protein. To test whether recombinant K6- Grsf1 itself (no GST domain) also exhibits RNA binding properties the recombinant fusion protein was cleaved employing the constructs unique thrombin cleavage site. After digestion the cleavage mixture was re- purified on a GSH-affinity column, which removes the GST protein. In this chromatographic procedure Grsf1 elutes in the flow-through fraction and was used for RNA binding assays. It can be seen from Fig. S2 that K6-Grsf1/GST fusion protein and cleaved K6-Grsf1 exhibit similar RNA binding activities. Interestingly, the shift signal of the purified K6-Grsf1 was observed at a slightly lower molecular weight range, which is consistent with the lower mass of K6-Grsf1 when compared with the fusion protein.





Fig. S2. Isolated K6-Grsf1 binds to the 5’-UTR of the m-GPx4 mRNA. The K6-Grsf1/GST fusion protein was expressed in E.coli and purified from the bacterial lysis supernatant by affinity chromatography on a GSH-affinity column. The bound proteins were eluted with an increasing step gradient of GSH and the purified K6-Grsf1/GST fusion protein was cleaved proteolytically employing the unique thrombin cleavage site of the construct. The digestion mixture was then run again over the GSH column and the liberated GST domain was retained on the column. The K6-Grsf1 protein was eluted in the flow- through and this fraction was used for comparative gel shift assays. A) K6-Grsf1/GST fusion protein, B) purified K6-Grsf1.







2.3. Grsf1 binds to a 27 nucleotide motif within the m-GPx4 5’UTR In order to further narrow down the binding region we constructed two additional RNA probes (5’UTR-B and 5’UTR-C) representing the middle and the 5’-part of the 5’-UTR, respectively (Fig. S3 A). As indicated in Fig. S3 C (panel I) only the 5’UTR-A probe revealed a strong shift signal (lane 1) whereas probes 5’UTR-B and 5’UTR-C (lane 2, 3) were ineffective. These data suggested that the putative binding sequence is localized in the 3’-part of the 5’-UTR. Finally (Fig. S3 B), we constructed an additional set of RNA probes (5’UTR-A1 to 5’UTR-A7) and observed that the most intense shift signals were obtained with probe 5’UTR-A4 and 5’UTR-A6 (Fig. S3 C, lane 7 and 9). In contrast, with probes 5’UTR-A1, 5’UTR-A2, 5’UTR-A3, 5’UTR-A5 and 5’UTR-A7 (lanes 4, 5, 6, 8 and 10) weak or no shift signals were detected. From these results one may conclude that the Grsf1 binding sequence is represented by a minimal 27 nt motif (probes 5’UTR-A4/A6) located close to the translational initiation site of m-GPx4.

[pic]

Figure S3. Grsf1 binds to a 37 nucleotide motif in the 5-UTR of the m- GPx4 mRNA. For additional RNA mobility shift assays different RNA probes were designed. These probes, which represent the complete 5’-UTR of the m- GPx4 mRNA partially overlap. Purified recombinant Grsf1/GST fusion protein was incubated with the different probes and the shift signals were analyzed as described in Fig. 2. Panel A: The three major probes 5’UTR-A, 5’UTR-B and 5’UTR-C cover the complete 5’-UTR of the m-GPx4 mRNA. The two major transcriptional initiation sites are indicated by a (Nam et al. 1997) and b (Knopp et al. 1999). Panel B: Exact sequences of probe 5’UTR-A and of a set of additional probes derived from this most active construct. Panel C: Gel shift patterns of the different probes using purified recombinant Grsf1/GST fusion protein.

2.4. Impact of siRNA treatment on global embryogenesis The impact of siRNA treatment on overall embryonic growth (embryo size measured by the crown rump length) and on embryonic brain development was measured during microscopic inspection of 27 different embryos. To judge cerebral embryogenesis we assessed the degree of brain maturation according to a standard scoring procedure, which is based on a number of morphological parameters (Maele-Fabry et al. 1990) with numerical scores ranging from 0 to 5. A score of 0 represents strong developmental retardations whereas a score of 5 indicates advanced cerebral embryogenesis. Applying this evaluation procedure we found that siRNA treatment significantly (P<0.001) impaired the growing process (reduced crown rump length) and specifically retarded the maturation of mid- and hindbrain (reduced midbrain and hindbrain scores). In contrast, forebrain development was hardly impacted (Table S2).

Table S2. Developmental retardation of siRNA treated embryos. The following morphological criteria were applied for the different parts of embryonic brain: Forebrain: prosencephalon invisible (score 0); V- shape (score 1); U-shape (score 2); partially fused (score 3); completely fuse (score 4); telencephalic evaginations (score 5). Midbrain: mesencephalic invisible (score 0); V-shape (score 1); U- shape (score 2); partially fused (score 3); completely fused (score 4); discernible division between mesencephalon and diencephalon. Hindbrain: rhombencephalon invisible (score 0); V-shape (score 1); U- shape (score 2); folds fused with anterior neuropore formed (score 3); anterior neuropore closure (score 4); dorsal flexion develops with 4th ventricle roof (score 5). Significances were calculated with the Student’s t-test.

|growth parameters |Control |Grsf1 siRNA |significance| | |siRNA | | | | |n=27 |n=28 | | |hindbrain |3.63±0.57 |2.25±0.93 |<0.0001 | |development | | | | |(score) | | | | |midbrain |3.56±0.51 |2.07±0.81 |<0.0001 | |development | | | | |(score) | | | | |forebrain |3.59±0.50 |3.61±0.57 |0.9200 | |development | | | | |(score) | | | | |crown rump length |3.01±0.20 |2.14±0.37 |<0.0001 | |(mm) | | | |

2.5. Murine genes with the Grsf1 recognition motif AGGGGA in their untranslated regions To identify further potential targets containing Grsf1 recognition motifs in their mRNAs, we performed an un-gapped BLAST search of a non- redundant database of untranslated regions (Altschul et al. 1997). Using this computational approach we identified twelve cDNAs that contain at least one AGGGGA-motif in their untranslated regions (Table S3).

Table S3. Genes containing the Grsf1 recognition motif (5’-AGGGGA-3’) in their untranslated regions. The names of the genes and the corresponding EMBL ID are given.

|sequences containing the AGGGGA recognition motif |EMBL | |in the 5’-untranslated region | |pantothenate kinase 3, mRNA (cDNA clone MGC:38148 |BC032188| |IMAGE:5321341) | | |early growth response 2 (Egr2), mRNA (Krox20) |NM_01011| | |8 | |renal munc13 mRNA |AF115848| |mRNA for testis-specific protein kinase 1 |AB003494| |In the 3’-untranslated region | |pro-alpha1 (II) collagen chain gene |M65161 | |neuralized -like homolog (Drosophila), mRNA (cDNA |BC099702| |clone MGC:106438 IMAGE:6825751) | | |RIKEN cDNA 1500016O10 gene, mRNA (cDNA clone |BC093505| |MGC:103222 IMAGE:4503230) | | |midasin homolog (yeast), mRNA (cDNA clone |BC085230| |IMAGE:30430592) | | |procollagen, type II, alpha 1, mRNA (cDNA clone |BC082331| |MGC:90638 IMAGE:30537724) | | |E2F transcription factor 3, mRNA (cDNA clone |BC059262| |IMAGE:6409341) | | |Ly6/neurotoxin 1, mRNA (cDNA clone MGC:36018 |BC037541| |IMAGE:5325123) | | |G protein-coupled receptor 108, mRNA (cDNA clone |BC016104| |MGC:27688 IMAGE:4920840) | |



3. References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D.J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25(17): 3389-3402.

Borchert, A., Wang, C.C., Ufer, C., Schiebel, H., Savaskan, N.E., and Kuhn, H. 2006. The role of phospholipid hydroperoxide glutathione peroxidase (GPx4) isoforms in murine embryogenesis. J Biol Chem.

Knopp, E.A., Arndt, T.L., Eng, K.L., Caldwell, M., LeBoeuf, R.C., Deeb, S.S., and O'Brien, K.D. 1999. Murine phospholipid hydroperoxide glutathione peroxidase: cDNA sequence, tissue expression, and mapping. Mamm Genome 10(6): 601-605.

Maele-Fabry, G.V., Delhaise, F., and Picard, J.J. 1990. Morphogenesis and quantification of the development of post-implantation mouse embryo. Toxic in Vitro 4: 149-156.

Nam, S., Nakamuta, N., Kurohmaru, M., and Hayashi, Y. 1997. Cloning and sequencing of the mouse cDNA encoding a phospholipid hydroperoxide glutathione peroxidase. Gene 198(1-2): 245-249.

Ryan, H.E., Poloni, M., McNulty, W., Elson, D., Gassmann, M., Arbeit, J.M., and Johnson, R.S. 2000. Hypoxia-inducible factor-1alpha is a positive factor in solid tumor growth. Cancer Res 60(15): 4010-4015.

Comments